1 introduction anatomy of human breast as a subject of scientific study

Báo cáo khoa học: The oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough lipopolysaccharide ppt

Báo cáo khoa học: The oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough lipopolysaccharide ppt

Ngày tải lên : 08/03/2014, 10:20
... of pH on the auto-oxidation of Hb A0 has been the subject of several studies Mansouri and Winterhalter [5] reported that the oxidation of the a chains of Hb A0 was 10 times faster than that of ... pH range from 5.3 to Tsuruga and Shikama [21] confirmed that the fast phase of oxidation was due to the a chains and the slow phase was due to the b chains Tsuruga et al found that the beta chain ... on the auto-oxidation of cross-linked Hb was studied The rate of decrease of the concentration of oxyHb increased as the pH was lowered over the range from pH 9.0–5.8 (data not shown) As was observed...
  • 6
  • 748
  • 0
Báo cáo y học: "valuation of a recombinant human gelatin as a substitute for a hydrolyzed porcine gelatin in a refrigerator-stable Oka/Merck live varicella vaccine." pps

Báo cáo y học: "valuation of a recombinant human gelatin as a substitute for a hydrolyzed porcine gelatin in a refrigerator-stable Oka/Merck live varicella vaccine." pps

Ngày tải lên : 11/08/2014, 10:23
... refrigerator-stable varicella vaccine formulation contains stabilizers such as sucrose, hydrolyzed porcine gelatin, phosphate, glutamate, and urea, as well as a live attenuated varicella virus (Oka/ Merck) and ... fragment (8.5 kDa) that can be used as a substitute for animal-derived material and has been shown to function as an effective alternative stabilizing ingredient in a live attenuated influenza ... biological materials of human or animal origin in vaccine formulations is a desirable trend in pharmaceutical industry To support this goal, recombinant human gelatin, termed FG-5001, was obtained...
  • 6
  • 289
  • 0
Báo cáo khoa học: Post-ischemic brain damage: targeting PARP-1 within the ischemic neurovascular units as a realistic avenue to stroke treatment pptx

Báo cáo khoa học: Post-ischemic brain damage: targeting PARP-1 within the ischemic neurovascular units as a realistic avenue to stroke treatment pptx

Ngày tải lên : 07/03/2014, 03:20
... pathophysiology of stroke patients, and neuroprotection should be evaluated on a long-lasting and functional basis, rather than on an acute and histological basis Also, careful and rigorous selection of patients ... Giovannelli L, Cozzi A, Guarnieri I, Dolara P & Moroni F (2002) Comet assay as a novel approach for studying DNA damage in focal cerebral ischemia: differential effects of NMDA receptor antagonists ... neurons has also been reported [56] Reduced expression of pro-inflammatory mediators is probably a result of the fact that inflammatory transcription factors such as nuclear factor-kappaB, activator...
  • 10
  • 417
  • 0
Báo cáo khoa học: Hematopoietic differentiation from human ESCs as a model for developmental studies and future clinical translations Invited review following the FEBS Anniversary Prize received on 5 July 2009 at the 34th FEBS Congress in Prague docx

Báo cáo khoa học: Hematopoietic differentiation from human ESCs as a model for developmental studies and future clinical translations Invited review following the FEBS Anniversary Prize received on 5 July 2009 at the 34th FEBS Congress in Prague docx

Ngày tải lên : 22/03/2014, 17:20
... Nature 460, 909–913 89 Hong H, Takahashi K, Ichisaka T, Aoi T, Kanagawa O, Nakagawa M, Okita K & Yamanaka S (2009) Suppression of induced pluripotent stem cell generation by the p53–p21 pathway ... engraftment was achieved using both methods as shown by expression of human CD45 3–6 months post-transplantation Additionally, secondary engraftment was achieved following intravenous transplantation ... a CD34+ hESC-derived starting population has been considered as a potential AIDS therapy, and as a way to alleviate secondary effects produced by anti-retroviral drugs [16] Various studies have...
  • 12
  • 550
  • 0
Occupation and Breast Cancer: A Canadian Case–Control Study docx

Occupation and Breast Cancer: A Canadian Case–Control Study docx

Ngày tải lên : 06/03/2014, 02:21
... Michigan 15 HUMAN RESOURCES DEVELOPMENT CANADA 1992 National Occupational Classification Ottawa, Canada 16 STATISTICS CANADA 1998 North American Industrial Classification System Ottawa, Canada 17 ... histories of breast cancer patients year research grant from Canadian Breast Cancer Research Foundation—Ontario Chapter 60 BROPHY, J., M KEITH, I LUGINAAH, et al 2003 Occupational histories of breast ... Sovan, and Peter Infante Funding was provided for the current Lifetime Histories Breast Cancer Research (LHBCR) by the Canadian Breast Cancer Foundation and the Breast Cancer Society of Canada...
  • 13
  • 463
  • 0
Dirty industry migration and the environment   china as a major case for study

Dirty industry migration and the environment china as a major case for study

Ngày tải lên : 14/09/2015, 18:30
... Cooperation APL Administrative Procedure Law of PRC (1989) ASEAN Association of Southeast Asian Nations ASRCC Annual Statistics Reports of Chinese Customs ATCA Alien Torts Claim Act BIT Bilateral Investment ... classical theories of comparative advantage It regards the environmental standard of a country as an important factor which shapes the country’s comparative advantage in international trade and ... removal of trade barriers such as tariffs, regulations, certain standards, legislation and regulatory measures, as well as removal of restrictions on capital flows and investments play a crucial...
  • 412
  • 903
  • 0
báo cáo khoa học: " Comparison of Radioimmuno and Carbon Nanotube Field-Effect Transistor Assays for Measuring Insulin-Like Growth Factor-1 in a Preclinical Model of Human Breast Cancer" doc

báo cáo khoa học: " Comparison of Radioimmuno and Carbon Nanotube Field-Effect Transistor Assays for Measuring Insulin-Like Growth Factor-1 in a Preclinical Model of Human Breast Cancer" doc

Ngày tải lên : 11/08/2014, 00:23
... a pattern of progressive adenocarcinoma with similar genetic changes and pathophysiology as seen in human breast cancers associated with BRCA1-mutations [11,12] Additionally, as in human BRCA1-associated ... IGF-1 was measured using (A) radioimmuno assay and (B) CNT-FET The impedance value for each IGF-1 measurement was normalized to the corresponding PBS baseline value Both assays show an increase ... impedance was measured for The impedance value for each IGF-1 measurement was normalized to the corresponding PBS baseline value Each sample was measured at least in quadruplicate using a fresh...
  • 6
  • 329
  • 0
Báo cáo y học: "Ku protein as a potential human T-cell leukemia virus type 1 (HTLV-1) Tax target in clastogenic chromosomal instability of mammalian cells" ppt

Báo cáo y học: "Ku protein as a potential human T-cell leukemia virus type 1 (HTLV-1) Tax target in clastogenic chromosomal instability of mammalian cells" ppt

Ngày tải lên : 13/08/2014, 09:21
... functions of these factors and could lead to increased DNA structural instability and progression of damage Progression of DNA structural damage may ultimately contribute to and mechanistically explain ... Polymerase in suppressing chromosomal aberrations and liver cancer formation Cancer Research 2002, 62:6990-6996 Li B, Navarro S, Kasahara N, Comai L: Identification and biochemical characterization ... studies have shown that upon DNA damage, PARP-1 (a nuclear enzyme which catalyzes the polyADP-ribosylation of target proteins in response to DNA damage) and Ku proteins are rapidly activated and compete...
  • 10
  • 356
  • 0
Tài liệu Module 1: Introduction to Advanced Administration of a Windows 2000 Network docx

Tài liệu Module 1: Introduction to Advanced Administration of a Windows 2000 Network docx

Ngày tải lên : 17/01/2014, 08:20
... Centralize Management Delegate Administrative Delegate Administrative Control Control Lead-in As an administrator, you can take advantage of the Windows 2000 Active Directory and Group Policy features ... network are also represented as objects By representing all network resources as objects in a centralized database, Active Directory enables a single administrator to centrally manage and administer ... install software, you can ensure that the same applications are available on any computer to which a user logs on You can also ensure that missing files and settings are repaired automatically...
  • 26
  • 444
  • 0
Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc

Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc

Ngày tải lên : 18/02/2014, 16:20
... 5¢-CACACTACACTGGGAAGCAGAGACTCCAGC-3¢ and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG3¢ The cDNA was subcloned into the EcoRV site of pBluescript SK(+) (Stratagene, La Jolla, CA, USA) and sequenced using an automated ... buffer, and the eluted samples were subjected to western blot analysis as described above The authors thank Drs Masato Yasui, Sadakazu Aiso and Masaaki Matsuoka for support; Dr Andrew P McMahon ... unclear However, it has a motif characteristic of the membrane-bound O-acyltransferase (MBOAT) superfamily [31], like Drosophila skinny hedgehog gene product and mammalian Skn, as well as yeast...
  • 14
  • 499
  • 0
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

Ngày tải lên : 06/03/2014, 09:22
... A1 , hnRNP E1 ⁄ E2 hnRNP A1 ASF ⁄ SF2 hnRNP A1 UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA GAAGAAGCGGAGACAGCGACGAAGA AGAUCCAUUCGAUUAG unknown UAGUGAAUAGAGUUAGGCAGGGA ... cells Proc Natl Acad Sci USA 91, 7311–7315 32 Kamata M, Nitahara-Kasahara Y, Miyamoto Y, Yoneda Y & Aida Y (2005) Importin-alpha promotes passage through the nuclear pore complex of human immunodeficiency ... coactivators J Virol 76, 9724–9734 HIV-1 alternative splicing regulation 34 Kuramitsu M, Hashizume C, Yamamoto N, Azuma A, Kamata M, Yamamoto N, Tanaka Y & Aida Y (2005) A novel role for Vpr of...
  • 10
  • 434
  • 0
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

Ngày tải lên : 06/03/2014, 22:21
... b-Actin GAAGAAGGGCCAGACGC CCTTCGCTGAGTTCCTGC ACATCAGCGGATACTACAGAG TTTGAATGGGCGAGTGATTG CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA ... AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGGGACACGATGC CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT ... particularly, clear cell adenocarcinomas, cervical squamous carcinomas, ovarian carcinomas, colorectal carcinomas, esophageal carcinomas, bladder carcinomas and non-small cell lung carcinomas CA9...
  • 13
  • 563
  • 0
Báo cáo khoa học: Novel repressor of the human FMR1 gene ) identification ¨ of p56 human (GCC)n-binding protein as a Kruppel-like transcription factor ZF5 ppt

Báo cáo khoa học: Novel repressor of the human FMR1 gene ) identification ¨ of p56 human (GCC)n-binding protein as a Kruppel-like transcription factor ZF5 ppt

Ngày tải lên : 07/03/2014, 05:20
... siRNA selection [43] The first siRNAZF5 5¢-GGUUGAGGAUGUGAAAUUCUU-3¢ and 5¢-GAAUUUCACAUCCUCAACCUU-3¢) matched bases 192–210; the second siRNAZF5 (5¢-GAGGAAGCAUGA GAAACUCUU-3¢ and 5¢-GAGUUUCUCAUGCUUCCU ... of DNA per dish was used in all experiments b-galactosidase assays were performed following standard protocols, using O-nitrophenyl-b-d-galactopyranoside as a substrate Relative b-galactosidase ... sequence (5¢-UAGUCCCAUUAGCAAAGG UUU-3¢ and 5¢-ACCUUUGCUAAUGGGACUAUU-3¢) was published previously [44] and used as a control The control siRNA sequence did not match any human mRNAs FEBS Journal 274...
  • 15
  • 472
  • 0
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

Ngày tải lên : 07/03/2014, 15:20
... 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT TGTCC-3¢; Site-2 mut, 5¢-GCGTCTCACCCTAGTAA TGGTAATGCTCCAAGGGTTTTTGTCC-3¢; ... gene and lg of control luciferase plasmid DNA (pGL3, Promega) were used for transfection CAT and luciferase activities were measured as described [17] DNase I protection assay Rat liver and HeLa ... carried out as described by Luciakova et al [13] MALDITOF analysis was performed in reflector mode using a Voyager-DE STR MALDI-TOF mass spectrometer (Applied Biosystems) Internal calibration was performed...
  • 8
  • 426
  • 0
MICROECONOMICSPrinciples and AnalysisFrank A. CowellSTICERD and Department of Economics London School of Economics December 2004.ii.ContentsContents List of Tables List of Figures Preface 1 Introduction 1.1 The rôle of microeconomic principles . potx

MICROECONOMICSPrinciples and AnalysisFrank A. CowellSTICERD and Department of Economics London School of Economics December 2004.ii.ContentsContents List of Tables List of Figures Preface 1 Introduction 1.1 The rôle of microeconomic principles . potx

Ngày tải lên : 08/03/2014, 10:20
... mathematics as well as brushing up on particular technical points Take an ordinary pencil with a sharpened point and place it on a ‡at table How many equilibria does it have? Which of them are ... on the basis of a few elementary assumptions about preference structure, but it is not at all clear that they are in fact a suitable way of encapsulating individuals’ motivation when faced with ... applied again and again to apparently dissimilar economic problems The student of microeconomics can exploit the fact that many basic problems have a common structure and that they can be analysed...
  • 668
  • 5.1K
  • 0
Báo cáo khoa học: Identification of mitogen-activated protein⁄extracellular signal-responsive kinase kinase 2 as a novel partner of the scaffolding protein human homolog of disc-large docx

Báo cáo khoa học: Identification of mitogen-activated protein⁄extracellular signal-responsive kinase kinase 2 as a novel partner of the scaffolding protein human homolog of disc-large docx

Ngày tải lên : 22/03/2014, 16:20
... mutagenic primers were: GRRF-PDZ1: 5¢GAAAGGGGAAATTCAGGGCGTCGT TTCAGCATTGCAGGAGG-3¢; GRRF-PDZ2: 5¢-ATTA AAGGTCCTAAAGGTCGTCGGTTTAGCATTGCTGGA GG-3¢; RAAV-MEK2: 5¢-CACCCACGCGCGCCGCCGT GTGA-3¢ and ... RT-PCR using PlatiniumÒ Taq DNA High Fidelity Polymerase (Invitrogen) and the primers: PDZ-1-2, forward: 5¢-CCGAATTCGAAGAAATCACACTTGAAAGG-3¢, and reverse: 5¢GGATCCCCATCATTCATATACATACTTGT GGGTT-3¢; ... 5¢-GTGGGGAAATATGCTCTTGAGGAGGT-3¢; primers 2, forward: 5¢-GTGACTTCAGAGACACTGCCA-3¢, and reverse: 5¢-CCCTTTCAAGTGTGATTTCTTC3¢; primers 3, forward: 5¢-ACCAGATGGTGAGAGCGAT-3¢, and reverse: 5¢-CTGTCTTTCATAGGTCCCAAT-3¢...
  • 11
  • 419
  • 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

Ngày tải lên : 18/06/2014, 16:20
... type diabetes subjects Immunogenetics 2010, 62:101-107 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association ... Cobbold S, Alyanakian MA, Gouarin C, Barriot S, Garcia C, Waldmann H, Bach JF, Chatenoud L: Autoimmune diabetes onset results from qualitative rather than quantitative age-dependent changes in pathogenic ... Health Center, 1650 Cedar Avenue, Montreal, H3G 1A4 , Qc, Canada Full list of author information is available at the end of the article thymic and peripheral CD4+ T cells in humans and mice, and...
  • 12
  • 573
  • 0
báo cáo hóa học:" Engagement of patients in religious and spiritual practices: Confirmatory results with the SpREUK-P 1.1 questionnaire as a tool of quality of life research" ppt

báo cáo hóa học:" Engagement of patients in religious and spiritual practices: Confirmatory results with the SpREUK-P 1.1 questionnaire as a tool of quality of life research" ppt

Ngày tải lên : 20/06/2014, 15:20
... P sub-scales, such as age, sex, marital status, educational level, religious affiliation, SpR attitude, disease and duration of disease Using the method of univariate analyses of variance we ... correlations among a set of variables, in order to achieve a set of more general "factors." VARIMAX-factor analysis was repeated rotating different numbers of items in order to arrive at a convergent ... covariate for any of the five forms of SpR practice • Disease itself has an impact on NoP (and a minor impact on HuP and USP), while the duration of disease has no impact on the forms of SpR practice...
  • 11
  • 425
  • 0
Báo cáo y học: "A comparative study of the inhibitory effects of interleukin-1 receptor antagonist following administration as a recombinant protein or by gene transfer." pps

Báo cáo y học: "A comparative study of the inhibitory effects of interleukin-1 receptor antagonist following administration as a recombinant protein or by gene transfer." pps

Ngày tải lên : 09/08/2014, 01:23
... situations, such as that reported in Figs and 5, the importance of maintaining the local level of IL-1Ra became dramatically apparent, as were the advantages of gene transfer as a means of protein ... demonstrated impressive efficacy in animal models of RA and OA, and a phase I human trial has recently confirmed that the human IL-1Ra cDNA can be safely transferred to and expressed within human ... cellular level, the advantage of gene transfer as a means of drug delivery arises from the sustained availability of IL-1Ra that this method permits Materials and method Materials Ham’s F12 medium,...
  • 9
  • 421
  • 0
báo cáo khoa học: "A Study to investigate the role of p27 and Cyclin E immunoexpression as a prognostic factor in early breast carcinoma" pptx

báo cáo khoa học: "A Study to investigate the role of p27 and Cyclin E immunoexpression as a prognostic factor in early breast carcinoma" pptx

Ngày tải lên : 09/08/2014, 01:24
... spread and vascular invasion with distant metastases free survival (MFS) in all invasive carcinomas and the subgroup of IDC in an univariate analysis However, there was no significant association ... prognostic value as there is a direct statistical association with the development of distant metastases in all invasive carcinomas, the subgroup of invasive ductal carcinomas and in the node negative ... this study was to investigate the role of p27 and cyclin E immunoexpression as a prognostic factor in early breast carcinoma Methods A database of all wide local excisions for breast carcinoma from...
  • 9
  • 423
  • 0

Xem thêm